FIMM Genomics Targeted Amplicon sequencing sample delivery
Make sure you contact core before sending your samples.
16S/18S/ITS sample requirements
- Normalized samples only (recommended concentrations 5, 10, 20ng/µl)
- Dissolved in water or low TE buffer (≤ 0,1mM EDTA)
- Volume used for amplification 2µl
- Purification of the isolated samples is highly recommended (e.g. DNeasy PowerClean Pro Cleanup Kit (cat no. 12997-50)). No reruns or tests will be performed in case of blank samples
- OD260/280 = 1.8-2.0; OD260/230 = 2-2.2
- Sample delivery on v-bottom 96 well plates filled by columns (A1, B1, C1 etc.) Leave empty wells at the end of the plate (e.g. F12, G12, H12). Empty wells between samples in the middle of the plate will be charged as reactions
- Default enzyme Phusion HF. Phusion GC can be used upon request
Sample requirements for other DNA samples
- Normalized samples only (recommended concentrations 5, 10, 20ng/µl)
- Dissolved in water or low TE buffer (≤ 0,1mM EDTA)
- Volume used for amplification 2µl
- Sample delivery on v-bottom 96 well plates filled by columns (A1, B1, C1 etc.) Leave empty wells at the end of the plate (e.g. F12, G12, H12). Empty wells between samples in the middle of the plate will be charged as reactions
- Default enzyme Phusion HF.
Sample requirements for PCR products
- To enable index primer attachment, PCR products need to have following adapters
- Adapter1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT before locus specific forward primer
- Adapter2 AGACGTGTGCTCTTCCGATCT before locus specific reverse primer
- Check your PCR products for blanks
- Sample delivery on v-bottom 96 well plates filled by columns (A1, B1, C1 etc.) Leave empty wells at the end of the plate (e.g. F12, G12, H12). Empty wells between samples in the middle of the plate will be charged as reactions
- Default enzyme Phusion HF.