Tissue-specific inducible vectors

To obtain the inducible promoter entry clones, please follow these steps:

1.

Fill in MATERIAL TRANSFER AGREEMENT (MTA) document. The MTA is for not-for-profit use only (research and teaching). Signature of a recipient scientist (often a PI) as well as an authorized official (typically, director or head of department/faculty) is required. Please, note that PIs don't typically have the right to act as an authorized official (check this from your university). Recipient scientist shall cause this agreement to be executed in two (2) copies and return one signed copy to Ari Pekka Mähönen, Institute of Biotechnology/Faculty of Biological and Environmental Sciences, Viikinkaari 1 (P.O.Box 65), 00014 University of Helsinki, Helsinki, Finland. Also scanned, electronic copy of the agreement and sent to AriPekka.Mahonen-ät-helsinki.fi is allowed. Once the signed copy is received, we can then proceed and post the requested XVE entry clones.

Please note that the material is subject to another MTA between University of Helsinki and the provider of the original material. This original MTA obligates us to use particular wording and terms in this MTA. Thus, the terms and wording are non-negotiable (cannot be changed) including the choice of law and jurisdiction no matter where you are from.

2.

Contact Ari Pekka Mähönen (AriPekka.Mahonen-ät-helsinki.fi), and indicate which XVE entry clones you would like to obtain. Please, remember to add also your full postal address and phone number for the plasmid delivery. We strongly recommend delivery via courier, since we have often noticed damage in the plasmids delivered via snail mail. So, in order to keep our plasmid delivery free-of-charge, we kindly ask you to provide us with your (or your institute's) FedEx account number.

3.

Upon receiving the material. The plasmids will be delivered on a Whatman filter paper. You can cut a piece of paper (inside of a marked area) and elute the plasmid out with 50-100 microliters of sterile water or TE buffer, and transform competent E. coli with a few microliters of the elute. Every XVE entry clone is ampicillin resistant in bacteria. Follow standard MultiSite Gateway® Three-Fragment Vector Construction Kit manual (Thermo Fisher Scientific, Catalog no. 12537-023) to carry out the subsequent LR reaction cloning step.

Reference: MultiSite Gateway compatible cell type-specific gene inducible system for plants. Siligato R, Wang X, Yadav SR, Lehesranta S, Ma G, Ursache R, Sevilem I, Zhang J, Gorte M, Prasad K, Wrzaczek M, Heidstra R, Murphy A, Scheres B, Mähönen AP. Plant Physiol. 2015 Dec 7. pii: pp.01246.2015.

Table 1: the list of available cell-type specific XVE inducible entry clones

Primers to sequence new promoters inserted in the p1R4-ML:XVE:
1R4_F: gttaacgctaccatggagct
XVE_3R: agcgccttcagatgttcttc

Frequently asked questions:

QUESTION: A colleague in the neighbouring lab is interested in trying the XVE entry clones. Can I pass the plasmids to my colleague?

ANSWER: Please, ask your colleague first to fill in the MTA (see above), obtain all the necessary signatures, and then contact Ari Pekka Mähönen by email (address above). Once the signed copy is received, your colleague can start working on the XVE entry clones.