DNA sequencing service

The laboratory has multiple platforms available for DNA sequencing, aiming at providing the best, most cutting-edge combination of sequencing approaches for the varying needs of our customers.

The DNA sequencing service is intended for all customers in universities, research institutes and companies. We are performing both conventional Sanger sequencing and high-throughput sequencing. The source material should be good quality DNA or RNA. Contact or for more information.

We advise customers to use Agilent's iLab Operations software to request sequencing services. 

You need to be registered to iLab in order to be able to do an order request. If you already have an iLab account you are able to use the ordering system directly.

How to register for an iLab account:

  1. Go to iLab HiLife login page
  2. All University of Helsinki and other Finnish university and research institute users should sign in using HAKA credentials
  3. During registration, you will be asked to enter your contact information and select your PI/Lab/Research Group from a dropdown menu
    1. If you are a PI you do not need to register - your account should be created by our financial integration and you can log in with your HAKA credentials
    2. If you do not see your PI on the list - please reach out to iLab Support
  4. Request an access to your PI/Lab/Research Group from the upper-left-hand corner. Select Manage Groups and click Request Group Access
  5. Registration event is complete when your PI has accepted your access and added a WBS(s) for you to use. You will get a Welcome email from iLab within one business day and thereafter you are ready to use iLab.

Please start using iLab from now on.

In case you need any assistance or help during registration or ordering - contact
Pia Laine () and Martyn James ().

Best regards,
Martyn James, Pia Laine
DNA Genomics and Sequencing

  • ABI Prism 3500xL (Applied Biosystems)

Sanger sequencing is a classical and widely used small scale DNA sequencing method. It requires a known primer, normal deoxynucleosidetriphosphates (dNTPs) and modified di-deoxynucleotidetriphopates (ddNTPs) and a DNA polymerase for obtaining >500 bp long sequence.

We sequence plasmids, PCR products and larger templates like cosmids, phages, BACs or PACs. It’s possible to use custom primers (5 pmol/µl) or you can choose from our common primers list.

 

 Template requirements

  • Quality: 
    Template quality and quantity are the most important factors affecting sequence length and quality. In more than 90% of failed sequencing reactions the cause is insufficient DNA quality. Errors in DNA quantification are also a recurrent problem. Quantification errors will not usually make the reaction fail completely, but they will seriously affect read lengths. Properties such as GC-content, repeats such as poly(A)-tails and loop structures affect sequencing reactions, so any information you can provide will help us select suitable reaction protocol.
  • Plasmids under 10 kb: 
    We require 5 µl of plasmid DNA for a single reaction in concentration of 100ng/µl. If plasmid is bigger than 10 kb, please refer to the procedures in large templates.
  • PCR products:
    We require 100 ng (min. concentration 20 ng/µl) of purified PCR product for a single reaction. Products should be >150 bp. Always tell us the length of the PCR product. We can also purify the PCR products. If you have unpurified products, include the picture of the agarose gel electrophoresis with loading amounts. Always check your PCR fragments on agarose gel. If you have any secondary bands - however faint - the fragment must be purified from gel.
  • Large templates (cosmids, BACs, PACs)
    We require 500 ng – 1µg of template DNA for reaction.

Primers

  • We have several standard primers for the most common vectors and for bacterial 16S rDNA sequencing. These primers are available for Sanger sequencing at no extra cost.
  • If you want to use your own primers, take good care that you design them suitable for sequencing. The primers will be delivered in separate tubes at concentration of 5µM. The amount per reaction needed is 1µl. When designing the primer, remember that the readable sequence will not start right after the primer and the sequence quality might be poor during the first 10-20 bases. Allow about 50 bases between your primer and the site of interest.

Output 

The primary output of the sequencers is graphical data, also called trace. The primary output is automatically interpreted by a program that gives text data, in other words the sequence output in letters (ACGT and IUPAC ambiguity codes). The graphic data is the most informative data, while the text data is prone to errors of interpretation due to imperfect primary data.

  • Trace file as .AB1-file (chromatograms)
  • Text file as seq1-file, manual proof-read.

The rawdata has been read through and the correction made, if necessary.

Output: All the result files will be zipped and delivered via iLab.

Softwares that can open trace-files:

  • Sequence Scanner
  • Staden package
  • Chromas
  • Finch
  • BioEdit

 

Plate format

You can also send us samples at 96-plate format. There are some things to consider before making an order at plate format.

Primer: The primer has to be same in all samples.

Sample size: The size of the templates should be approximately the same. Don’t mix the PCR-product of 200 bp and plasmids at the same plate.

Concentration: We use the same volume of the templates for reaction. So make sure the concentrations are almost the same.

Sample order at the plate: Notice that we have 16 capillarymachine and the sample will be run at order starting well A01, B01, C01.., so fill in your plate from up to down, left to right.

Sample names: The samples will be named by well numbers, but it’s possible to add your own sample name to the file. We need a sample list at excel-form. You can send it by mail.

Output:  All the result files will be zipped and delivered via iLab.

 

 

 

Service protocol:

PCR products have been purified by Milliporen MultiScreen PCR 96. (Cat No. LSKMPCR50)

Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit (Part No. 4336921). The sequencing reactions have been made by using the protocol recommended by manifacturer.

Sequencing reactions with Applied Biosystems ABI350xL Genetic Analyzer (24-capillaries).

 

Fragment analysis

We have a fragment analysis service where customers can bring us ready-made labelled samples. The service includes cleaning of the sample, fragment analysis run by 3130xl and the size standard. Possibility of digestion for labelled PCR products is also available. Cleaning of the samples, if necessary, is done either by Millipore 96 PCR purification plate or using Agencourt AmPure chemistry. We perform a preliminary analysis to check that the run was completed properly and that the size standard works. Analysing of the samples is done by the customer. Recommended analysis software for our customers is the Peak Scanner which is available at Applied Biosystems website.

Fragment sets:

Filter set D (ds-30)    6-FAM, HEX, NED
ABI 3130       size std ROX

Filter set G5 (ds02)      dR110, dR6G, dTAMRA,
ABI 3130       dROX and size std LIZ

We currently have the following size standards:

GeneScan 1000 ROX, GeneScan 500 ROX and GeneScan 120 LIZ from Applied Biosystems. MapMaker 1000 ROX from BioVentures.

High throughput sequencers

 

Short read sequencers

ISeq and MiSeq  are both Illumina’s NGS (next-generation sequencing) systems that uses sequencing-by-synthesis (SBS) chemistry. Both have their advantages and therefore sequencing system is selected based on the customer's need. MiSeq produces longer paired end reads (2X~300 bp, ~20*106 - 40*106 read pairs/run) depending on the used sequencing kits. iSeq 100 sequencing system is suitable for small and low throughput sequencing projects. MiSeq is used mainly for amplicon sequencing, eg. bacterial 16S rRNA or fungal ITS, and small microbial sequencing followed by assembly or mapping to reference sequence. NovaSeq is used for large sequencing projects.

AVITI from Element Biosciences is the newest short read benchtop sequencer in house. It has has two independent sequencers in one and four flow cells in total. Avidity sequencing employs rolling circle amplification (RCA) to minimize common amplification errors and therefore it has the industry-leading accuracy (>90% >Q30) in its data.     

 

Long read sequencers

PacBio Revio instrument by Pacific Biosciences represent our “third-generation sequencing” technology in which single molecules are sequenced. We updated Sequel II instrument to Revio in early 2024. The Revio System has 3X higher data throughput than its predecessor at the same cost. The Revio system adds affordability, high throughput, and ease of use to a foundation of long reads, exceptional accuracy, and direct methylation detection. PacBio HiFi long read sequencing is suitable for whole genome sequencing, targeted sequencing, RNA sequencing, epigenetics and microbiome + metagenomic sequencing.

Promethion-2-Solo is a small benchtop real-time sequencer from Oxford Nanopore. We purchased this instrument in spring 2023 and so far we have been sequencing direct RNA and ultra-high molecular weight DNA. 

 

 

Amplicon sequencing

Illumina short-reads

Standard metagenomic amplicon-seq reactions available
 

  1. 16S V3-V4 (341F and 785R primers)
  2. 16S V1-V3 (pA and pD' primers)
  3. 16S (V4-V6) (Q515F and V6_rev primers)
  4. 16S (V4) (515F and 806R primers)
  5. ITS1 (ITS-1F and ITS-2R primers)
  6. ITS2 (ITS3, ITS4 and ITS7 primers)

 

Samples accepted

We can perform Amplicon-seq from both DNA and PCR amplicon starting material. PCR amplicons should contain the appropriate TruSeq or Nextera overhang sequence for Illumina or 18F/R overhang sequence for PacBio that will allow us to "index" the amplicon with a unique barcode.

 

TruSeq amplicon overhangs:

Forward: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-[Your forward primer]-3’

Reverse: 5’- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-[Your Reverse primer]-3’

 

In exceptional circumstances we can also provide a DNA isolation service

 

Requested Delivery format Illumina and PacBio
 

DNA samples

  1. Volume required: 10 ul or more
  2. Optimum DNA concentration 5-10 ng/ul (this is only a guideline – success will depend upon the functional bacterial/fungal content of the sample)
  3. Samples should be eluted in either water or low TE buffer (0,1 mM EDTA )
  4. Nanodrop 260/280 absorbance ratio 1.8–2 and 260/230 ratio of 2–2.2
  5. Deliver samples in individual microfuge tubes
  6. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order
  7. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ, Ä, Ö, Å
  8. Samples should not be named 1,2,3 etc Please use a unique name or add a prefix with your initials or project name

 

PCR Amplicons with overhangs

  1. Please provide unpurified PCR reactions - we will ExoSAP treat in the lab before barcoding
  2. Volume required 10 ul or more
  3. Tubes, 8-tube strips or transparent 96-well PCR plates (v-bottom)
  4. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order
  5. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ
  6. Samples should not be named 1,2,3 etc Please use a unique name or add a prefix with your initials or project name
  7. PCR plates should be sealed with an adhesive plate seal that does not peal off when frozen
  8. PCR plates should be filled in the order A1, B1, C1 etc. Empty wells in a plate will be treated as sample and charged
  9. If possible please provide an Agarose gel picture of your PCR products

 

Negative controls

We strongly recommend that you provide negative control samples (DNA isolation without input material). As part of the service we perform negative control PCR reactions with water as input.

Illumina RNA Sequencing

Illumina short reads for:

Whole transcriptome (mRNA and lncRNA)
Coding transcriptome (mRNA)
Small RNA (e.g. miRNA)
Metatranscriptome (i.e. mixed species samples)

 

For whole transcriptome Total RNA need to be ribo-depleted to remove rRNA.

We offer ribo-depletion for:

  1. Mammalian
  2. Plant
  3. Pan-prokaryotic / fungi / archea
  4. Custom projects (e.g. Chicken, Drosophila, Zebrafish etc)

 

Illumina short-reads preps available for whole transcriptome, coding transcriptome (mRNA) and metatranscriptome
 

  1. Illumina TruSeq (Whole transcriptome) or Tecan Ovation Solo RNA-seq (for ultra-low RNA input)
  2. Illumina Stranded mRNA prep (Coding transcriptome)
  3. NEBNext Ultra II Directional RNA Library prep Kit for Illumina (Whole and Coding transcriptome)

 

Illumina short-reads preps available for miRNA

  1. Illumina TruSeq Small RNA Library

 

Requested Delivery format
 

RNA samples

  1. Volume required: 15 ul or more (10 ul for small RNA prep)
  2. RNA should be DNase treated
  3. Both Whole and Coding transcriptomes require a total of 100 - 1000 ng input
  4. All samples should be delivered to BIDGEN at the same RNA concentration. Optimum RNA concentration 10-50 ng/ul
  5. Small RNA library optimum RNA concentration 2-10 ng/ul of purified small RNA or 200 ng of Total RNA
  6. Individual microfuge tubes
  7. Sample names should be unique
  8. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order/Excel sheet
  9. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ, Ä, Ö, Å
  10. Samples should not be named 1,2,3 etc Please add a prefix with your initials or project name
Illumina DNA Sequencing

For sequencing of whole genomes and metagenomes

 

Illumina short-reads preps available
 

Illumina DNA prep (transposon-based)

NEBNext Ultra II FS DNA Library Prep for Illumina

 

PCR-free

Illumina DNA prep PCR-free

Thermo Collibri PCR-free

 

 

DNA sample requirements

  1. Illumina DNA prep (optimum 50-250 ng at a concentration of around 10-50 ng/ul). We can accept down to 1 ng per rxn (approx 100 pg/ul)
  2. NEBNext: "< 100 ng" (100 pg - 100 ng) or "> 100 ng" (100-500 ng). > 100 ng corresponds to concentration of 4-20 ng/ul
  3. Illumina DNA prep PCR-free (100-500 ng). 500 ng input corresponds to concentration of 20-250 ng/ul
  4. Collibri PCR-free (100-500 ng). 500 ng input corresponds to concentration of 15-250 ng/ul
  5. Please quantify DNA concentration with Qubit. NanoDrop may overestimate the DNA concentrations of your samples
  6. Maximum EDTA concentrations allowed in your sample: Illumina DNA prep (1 mM), NEBNext (1 mM), Illumina DNA prep PCR-free (1 mM), Collibri PCR-free (0 mM EDTA - EDTA can be removed with bead wash)
  7. Sample should be free of phenol, ethanol, and other organic contaminants.
  8. Nanodrop 260/280 absorbance ratio 1.8–2 and 260/230 ratio of 2–2.2

 

In exceptional circumstances we can also provide a DNA isolation service

 

Requested Delivery format (Illumina DNA prep)
 

  1. Volume required: At least 20 ul
  2. Optimum DNA concentration 10-50 ng/ul (Illumina DNA prep)
  3. In sample batches, DNA concentrations should be in the same range (excluding negative control samples)
  4. Accepted batch sample ranges (ng/ul): (10-50 (optimum), 10-20, 5-10, 2-5 or 0.2-2)
  5. Individual microfuge tubes
  6. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order/Excel sheet
  7. Sample names should be unique
  8. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ, Ä, Ö, Å
  9. Samples should not be named 1,2,3 etc Please add a prefix with your initials or project name
PacBio DNA Sequencing

For Whole Genome and Metagenomes sequencing

 

Service includes

  1. SMRTbell library prep
  2. Pooling of samples (up to 60 samples per pool)
  3. Sequencing on Revio SMRT cell - estimated 4.5-6M HiFi reads/SMRT cell. One human sample/SMRT cell = estimated 20-30 x coverage
  4. Average read length of genomic DNA depends upon the sample quality. For good quality mammalian samples read length would be around 10-25 kbp
  5. Use of PacBio SMRTlink pipeline to generate HiFi reads
  6. Sending of data (fastq or/and bam files) - please ensure that you have around 2 Tb of disc space/SMRT cell on your server

 

DNA isolation service

  1. From human or mammalian blood
  2. From animal tissue (e.g. muscle, liver etc)
  3. Tissue should be as fresh as possible or flash frozen

 

DNA sample requirements

  1. Animal or plant samples: 6-10 ug of Total DNA
  2. Bacteria/Metagenomes: Normally 2 ug plus of Total DNA (0.5-1 ug for good-quality unfragmented DNA)
  3. DNA should be as unfragmented as possible in order to get long reads (e.g. use wide-bore pipette tips and vortex as little as possible)
  4. Plant samples should be free from contaminants ( e.g carbohydrates and polyphenols)
  5. Sample should be free of phenol, ethanol, and other organic contaminants used to isolate the DNA
  6. Nanodrop 260/280 absorbance ratio 1.8–2 and 260/230 ratio of 2–2.2
  7. Please ensure that you have around 2 Tb of available disc space/SMRTcell on your server. Sensitive human data requires encryption of the data and availability of disc space on a secure server (e.g. ePouta for CSC users)
     

 

Requested DNA sample delivery format (PacBio)
 

  1. Volume required: 30-50 ul or more
  2. Individual microfuge tubes
  3. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order/Excel sheet
  4. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ, Ä, Ö, Å
  5. Samples should not be named 1,2,3 etc Please add a prefix with your initials or project name
PacBio RNA Sequencing

Kinnex full-length RNA for isoform sequencing

 

Service includes

  1. Iso-seq library prep
  2. Kinnex prep allows multiplexing of 1-12 samples and 8-fold concatenation (S-freads)
  3. Sequencing on Revio SMRT cell gives an estimated 4.5-6M full length RNA arrays/SMRT cell and 30-50M S-reads/SMRTcell
  4. Average read length of mRNA transcripts depends upon the sample quality. For good quality samples around 1500 bp (+)
  5. Use of PacBio SMRTlink pipeline to generate HiFi reads
  6. Sending of data (fastq files) - please ensure that you have around 2 Tb of free space/SMRT cell on your server

 

RNA sample requirements

  1. Input requirement is 300 ng/reaction
  2. RNA should be at least 50 ng/ul
  3. RNA should be as unfragmented as possible. RNA samples can be run on a fragment analyzer (e.g. Bioanalyzer) to assess RNA integrity.
  4. RNA should if possible be DNAase treated. Genomic DNA may interfere with accuarte quantification of your samples
  5. Please quantify RNA concentration with Qubit. NanoDrop may overestimate the RNA concentrations of your samples
  6. Sample should be free of phenol, ethanol, and other organic contaminants.
  7. Nanodrop 260/280 absorbance ratio 1.8–2 and 260/230 ratio of 2–2.2
  8. Please ensure that you have around 2 Tb of available disc space/SMRTcell on your server. Sensitive human data requires encryption of the data and availability of disc space on a secure server (e.g. ePouta for CSC users)

 

Requested Delivery format: PacBio Iso-Seq
 

RNA samples

  1. Volume required: 15 ul or more
  2. Optimum RNA concentration 50 ng/ul or more
  3. Individual microfuge tubes
  4. Clearly labelled (permanent marker pen) and have identical names to those added to the ilab order/Excel sheet
  5. Sample names should not contain any "white space" or the characters: ? ( ) [ ] / \ = + < > : ; " ' , * ^ | & . # µ, Ä, Ö, Å
  6. Samples should not be named 1,2,3 etc Please add a prefix with your initials or project name
Other instruments

In common use:

  • Bioanalyzer (Agilent)
  • Digital droplet PCR QX 200 (Bio-Rad)
  • LightCycler LC480 qPCR (Roche)
Genome projects

Genome sequencing projects have changed their nature since the invention of the NGS machines 454, Solid and Illumina. We initiated sequencing genomes using 454 GS20 in late 2006 targeting microbe genomes first. Thereafter the rapid development of sequencing technologies has continuously enlarged the scope of genomes that can be assembled using current approaches. Parallel to the DNA sequencing developments also the related bioinformatics approaches has made it possible to handle and take advantage of the newly created data.

For de novo genome sequencing projects the genome size usually dictates the approach one needs to take. Approximately 10 years ago microbes genomes were still assembled using a hybrid of so called short read technologies including matepair libraries and possible PacBio long reads assembled as a hybrid. Now most of the microbe genomes can be assembled using the PacBio long read technology together with suitable bioinformatics approaches. Fungal genomes up to several megabases can also be assembled using PacBio data. Though high-molecular weight DNA sample is still needed in order to get long continuous DNA sequences. More complex eukaryotic genomes can also be assembled using PacBio Revio (Sequel II) long HiFi data.

Fosmid clones and Bac clones can be assemble using short read or long read technologies but they are used rarely today. However, very complex genomes like some plants still benefit of the bac clones that can usually be assembled using PacBio and Oxford Nanopore long reads. When the average sequencing length has increased similarly the ability to resolve repeats has increased. In cases the Sanger sequencing is still used in the validation steps when NGS data cannot resolve some details in the genome.

During the last few years population genetics of sc. non model species has increased in popularity. Due to the large and fast turnaround time of short read (AVITI or Novaseq) resequencing of also eukaryotic genomes can be reached. When smaller genome are studied Miseq give a good choice due to longer reads thus ending up with better assemblies and higher mapping percentage for genomes. 

Computing & bioinformatics

We have an impressive capacity of hardware for scientific computing at our use. The lab internal server system consists of about 10 high performance computing nodes. Of these, four have 1TB (1,000 gigabytes) of Random Access Memory both with 64 processors. With these resources, we are most capable of running any foreseeable bioinformatics computing job as well as web services for collaborative purposes such as BLAST or WebApollo.

Our computing resources are also supplemented by those provided by the Finnish IT Center for Science (CSC).

We advise you to trim adapter sequences from your Illumina reads before any further analysis. We have the most experience from cutadapt program (|)

Sequences to trim from Illumina single-end or paired-end reads:

TruSeq library

R1 read: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

R2 read: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG

Nextera library

R1&R2 reads: CTGTCTCTTATACACATCT