The DNA sequencing service is intended for all customers in universities, research institutes and companies. We are performing both conventional Sanger sequencing and high-throughput sequencing. The source material should be good quality DNA or RNA. Contact petri.auvinen@helsinki.fi or martyn.james@helsinki.fi for more information.
You need to be registered to iLab in order to be able to do an order request. If you already have an iLab account you are able to use the ordering system directly.
How to register for an iLab account:
Please start using iLab from now on.
In case you need any assistance or help during registration or ordering - contact
Pia Laine (pia.k.laine@helsinki.fi) and Martyn James (martyn.james@helsinki.fi).
Best regards,
Martyn James, Pia Laine
DNA Genomics and Sequencing
Sanger sequencing is a classical and widely used small scale DNA sequencing method. It requires a known primer, normal deoxynucleosidetriphosphates (dNTPs) and modified di-deoxynucleotidetriphopates (ddNTPs) and a DNA polymerase for obtaining >500 bp long sequence.
We sequence plasmids, PCR products and larger templates like cosmids, phages, BACs or PACs. It’s possible to use custom primers (5 pmol/µl) or you can choose from our common primers list.
Service protocol:
PCR products have been purified by Milliporen MultiScreen PCR 96. (Cat No. LSKMPCR50)
Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit (Part No. 4336921). The sequencing reactions have been made by using the protocol recommended by manifacturer.
Sequencing reactions with Applied Biosystems ABI3130XL Genetic Analyzer (16-capillaries).
We have a fragment analysis service where customers can bring us ready-made labelled samples. The service includes cleaning of the sample, fragment analysis run by 3130xl and the size standard. Possibility of digestion for labelled PCR products is also available. Cleaning of the samples, if necessary, is done either by Millipore 96 PCR purification plate or using Agencourt AmPure chemistry. We perform a preliminary analysis to check that the run was completed properly and that the size standard works. Analysing of the samples is done by the customer. Recommended analysis software for our customers is the Peak Scanner which is available at Applied Biosystems website.
Fragment sets:
Filter set D (ds-30) 6-FAM, HEX, NED
ABI 3130 size std ROX
Filter set G5 (ds02) dR110, dR6G, dTAMRA,
ABI 3130 dROX and size std LIZ
We currently have the following size standards:
GeneScan 1000 ROX, GeneScan 500 ROX and GeneScan 120 LIZ from Applied Biosystems. MapMaker 1000 ROX from BioVentures.
PacBio Sequel II (Pacific Biosciences)
MiSeq and NextSeq500 are both Illumina’s NGS (next-generation sequencing) systems that uses sequencing-by-synthesis (SBS) chemistry. Both have their advantages and therefore sequencing system is selected based on the customer's need. MiSeq produces longer paired end reads (2X~300 bp, ~20*106 - 40*106 read pairs/run) whereas NextSeq500 read length is shorter (75 bp to 150 bp), depending on the used sequencing kits. The main advantage of NextSeq500 is high read throughput >400*106 reads/run and therefore it is the most suitable platform for large genomes and RNA-Seq where sequencing coverage is an essential factor for proper analyses. MiSeq is used mainly for amplicon sequencing, eg. bacterial 16S rRNA or fungal ITS, and small microbial sequencing followed by assembly or mapping to reference sequence.
PacBio Sequel II instrument by Pacific Biosciences represent our “third-generation sequencing” technology in which single molecules are sequenced. It is suitable platform for whole genome sequencing of small genomes, targeted sequencing, long amplicon sequencing, RNA sequencing of targeted transcripts and microbial epigenetics.
We updated RSII instrument to Sequel II in spring 2020. The Sequel II System has a higher data throughput with greater accuracy, at a significantly lower cost. PacBio read length and N50 has increased since we obtained the machine 2012 from 3000 bp up to 60-74 kbp and from 1500 bp up to tens of kbp, respectively. Read length and yield obtained from sequencing runs is highly dependent of the sample material. In addition to the DNA sequence as such PacBio gives also location and partial identification of the DNA modifications which is a coverage dependent. The coverage needed varies from modification to modification and from species to species.
We have mainly used this platform for whole genome sequencing both prokaryotes and eukaryotes and targeted, like long amplicon, sequencing and microbial epigenetics.
Single cell proteomics and genomics (ProtGen) facility
ProtGen core unit belonging to Institute of Biotechnology which is part of the Helsinki Institute of Life Science (HiLIFE) at the University of Helsinki develops and provides single cell proteomics and genomics services. Currently we are providing single cell services on three platforms: Polaris, Helios and InDrop.
The Fluidigm Polaris™ single cell platform enables to select targeted single cells from cell samples and hold them in environmentally controlled reaction chambers enabling perturbations with RNAseq readout.
InDrop single cell platform enables analysis, sorting and sequencing of tens of thousands of individual cells in straightforward, inexpensive experiments.
For single cell proteomics we provide services on Fluidigm Helios™, a platform based on mass cytometry, which has catalyzed the revolution of single cell proteomics enabling the comprehensive understanding of cell phenotypes and function.
More information will be coming soon, but currently interested should contact
pekka.katajisto@helsinki.fi
NanoString nCounter (NanoString technologies)
This approach uses single molecule probes to identify DNA, RNA or proteins in samples. One can detect up the 800 genes (RNA) in one assay mixing both miRNA and mRNA in one assay. For RNA detection total RNA (100 ng) is enough for simultaneous detection of all the probes in one assay. No cDNA phase needed single molecule detection is made using a scanner build for the purpose.
In common use:
Genome sequencing projects have changed their nature since the invention of the NGS machines 454, Solid and Illumina. We initiated sequencing genomes using 454 GS20 in late 2006 targeting microbe genomes first. Thereafter the rapid development of sequencing technologies has continuously enlarged the scope of genomes that can be assembled using current approaches. Parallel to the DNA sequencing developments also the related bioinformatics approaches has made it possible to handle and take advantage of the newly created data.
For de novo genome sequencing projects the genome size usually dictates the approach one needs to take. Few years ago microbes genomes were still assembled using a hybrid of so called short read technologies including matepair libraries and possible PacBio long reads assembled as a hybrid. Now most of the microbe genomes can be assembled using the PacBio long read technology together with suitable bioinformatics approaches. Fungal genomes up to several megabases can also be assembled using PacBio data. Though long DNA sample is still needed in order to get long continuous DNA sequences. Eukaryotic genomes can also be assembled using pure PacBio data but still often short read data (usually Illumina) is used to increase accuracy of primary sequence. The nanopore sequencers are on the testing phase at the moment waiting for improving primary accuracy and yield.
Fosmid clones and Bac clones can be assemble using short read or long read technologies but they are used rarely today. However, very complex genomes like some plants still benefit of the bac clones that can usually be assembled using PacBio long reads. When the average sequencing length has increased similarly the ability to resolve repeats has increased. The N50 of PacBio run exceeds 10 kbp and as a consequence of that longer repeated portion of the genomes can now be ordered. In cases the Sanger sequencing is still used in the validation steps when NGS data cannot resolve some details in the genome.
During the last few years population genetics of sc. non model species has increased in popularity. Due to the large and fast turnaround time of NextSeq500 resequencing of also eukaryotic genomes can be reached. When smaller genome are studied Miseq give a good choice due to longer reads thus ending up with better assemblies and higher mapping percentage for genomes. The NextSeq is also very suitable platform for various RNA seq methods.
We have an impressive capacity of hardware for scientific computing at our use. The lab internal server system consists of about 10 high performance computing nodes. Of these, four have 1TB (1,000 gigabytes) of Random Access Memory both with 64 processors. With these resources, we are most capable of running any foreseeable bioinformatics computing job as well as web services for collaborative purposes such as BLAST or WebApollo.
Our computing resources are also supplemented by those provided by the Finnish IT Center for Science (CSC).
We advise you to trim adapter sequences from your Illumina reads before any further analysis. We have the most experience from cutadapt program (cutadapt wiki | link to publication)
Sequences to trim from Illumina single-end or paired-end reads:
TruSeq library
R1 read: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
R2 read: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG
Nextera library
R1&R2 reads: CTGTCTCTTATACACATCT